Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2154 
Type of strain Targeted mutant. 
Strain name STOCK-Adam3tm1(KOMP)Osb/11B 
Internal Code Adam3 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Adam3 
Gene name a disintegrin and metallopeptidase domain 3  
Allele symbol Adam3tm1(KOMP)Osb 
Allele name a disintegrin and metallopeptidase domain 3 , targeted mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:102518 
Chromosome 8 (13.09) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer #5319  ATCCGGGGGTACCGCGTCGAG 
#6042  ACAGCTCACTCCATTGCATTTGCC 
 
 Primer 2
  PCR Primer #6043  CTGGTTAGCACACAAGCAAAGGGG 
 

 Reference information
 reference information 1
  Author
Fujihara Y, Oji A, Kojima-Kita K, Larasati T, Ikawa M. 
Title Co-expression of sperm membrane proteins CMTM2A and CMTM2B is essential for ADAM3 localization and male fertility in mice. 
Journal J Cell Sci 
Volume 2018 Oct 8;131(19) 
Page pii: jcs221481. doi: 10.1242/jcs.221481. 
Year 2018 
PMID