Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2151 
Type of strain Targeted mutant. 
Strain name STOCK-Plac1tm1(KOMP)Osb/7 
Internal Code Plac1 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Plac1 
Gene name placental specific protein 1 
Allele symbol Plac1tm1(KOMP)Osb 
Allele name placental specific protein 1, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University 
MGI MGI:1926287 
Chromosome X (29.31) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer #5319  ATCCGGGGGTACCGCGTCGAG 
#5706  GTTCACTCAGATGATCTGAGGAAACCC 
 
 Primer 2
  PCR Primer #5707  ACCCAGGCACCAATGCTAGC 
 

 Reference information
 reference information 1
  Author
Muto M, Fujihara Y, Tobita T, Kiyozumi D, Ikawa M. 
Title Lentiviral Vector-Mediated Complementation Restored Fetal Viability but Not Placental Hyperplasia in Plac1-Deficient Mice. 
Journal Biol Reprod 
Volume 94(1) 
Page
Year 2016 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development