Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Reference 
 Strain information
Type of strain Targeted mutant. 
Strain name STOCK Pdilttm1Osb/70 
Internal Code Pdilt KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name protein disulfide isomerase-like, testis expressed 
Allele symbol Pdilttm1Osb 
Allele name protein disulfide isomerase-like, testis expressed, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University 
MGI MGI:1919080 
Chromosome 7 (63.90) 
Gene classification Targeted or trapped gene(knockout etc.) 
 Primer 1
  PCR Primer 4484  atggaactgctttggacacc 
4485  aatactcacggaaaatcacc 
 Primer 2
  PCR Primer 114  ATCTggACgA AgAgCATCAg 

 Reference information
 reference information 1
Tokuhiro K, Ikawa M, Benham AM, Okabe M. 
Title Protein disulfide isomerase homolog PDILT is required for quality control of sperm membrane protein ADAM3 and male fertility [corrected]. 
Journal Proc Natl Acad Sci U S A 
Volume 109(10) 
Page 5905 
Year 2012