Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2147 
Type of strain Targeted mutant. 
Strain name C57BL/6-Syngr4tm1Osb 
Internal Code Syngr4 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Syngr4 
Gene name synaptogyrin 4 
Allele symbol Syngr4tm1Osb 
Allele name synaptogyrin 4, targeted mutation 1, Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
MGI MGI:1928903 
Chromosome 7 (29.58) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer #5731  CAACACCCCTGCCCCTACCTCC 
#5335  CCTGTCTGCTTCTCTCCCTCTCTG 
 
 Primer 2
  PCR Primer #2727  CAGCCTCTGAGCCCAGAAAGCG 
 

 Reference information
 reference information 1
  Author
Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.  
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. 
Journal Proc Natl Acad Sci U S A. 
Volume 113(28) 
Page 7704-10 
Year 2016 
PMID