Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name C57BL/6-Tepptm1a(KOMP)Osb/88 
Internal Code Tepp KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method In-house breading.
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name testis, prostate and placenta expressed 
Allele symbol Tepptm1a(KOMP)Osb 
Allele name testis, prostate and placenta expressed, targeted mutation 1a,Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
MGI MGI:1920657 
Chromosome 8  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
  PCR Primer #5083  actgatggcgagctcagacc 
#5381  tcaactatctgactccctgg 
 Primer 2
  PCR Primer #5862  gagtatcttggagtccccatctcaccc 
#5863  ggatcttggttaggggttgcaagcg 

 Reference information
 reference information 1
H. Miyata, J.M. Castaneda, Y. Fujihara, Z. Yu, D.R. Archambeault, A. Isotani, D. Kiyozumi, M.L. Kriseman, D. Mashiko, T. Matsumura, R.M. Matzuk, M. Mori, T. Noda, A. Oji, M. Okabe, R. Prunskaite-Hyyrylainen, R. Ramirez-Solis, Y. Satouh, Q. Zhang, M. Ikawa, M.M. Matzuk 
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice 
Journal Proc. Natl. Acad. Sci.  
Volume 113 
Page 7704-7710 
Year 2016 
 Disease , Applicable field information
  Disease name,
Applicable field