Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2141 
Type of strain Targeted mutant. 
Strain name B6D2-Ly6ktm1Osb 
Internal Code Ly6k KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ly6k 
Gene name Lymphocyte antigen 6 complex, locus K 
Allele symbol Ly6ktm1Osb 
Allele name lymphocyte antigen 6 complex, locus K, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University 
MGI MGI:1923736 
Chromosome 15 (34.28) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer #719  GCCTTCTATCGCCTTCTTGACGAGTTCTTC 
#5577  GCAAGGCCACTAGGAACGCC 
 
 Primer 2
  PCR Primer #5578  GGCACGGGCTGCTGAGG 
 

 Reference information
 reference information 1
  Author
Fujihara Y, Okabe M, Ikawa M. 
Title GPI-anchored protein complex, LY6K/TEX101, is required for sperm migration into the oviduct and male fertility in mice. 
Journal Biol Reprod 
Volume 90(3) 
Page 60 
Year 2014 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Others