Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2140 
Type of strain Targeted mutant. 
Strain name C57BL/6N-Wbp2nltm1a(EUCOMM)Osb 
Internal Code PAWP KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Wbp2nl 
Gene name WBP2 N-terminal like 
Allele symbol Wbp2nltm1b(EUCOMM)Osb 
Allele name WBP2 N-terminal like, targeted mutation 1b, Research Institute for Microbial Diseases,Osaka University 
MGI MGI:1921966 
Chromosome 15 (38.56) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer #5438  GCTTCCTCTGGCTTGCTCAGCTTGCTTTC 
#5083  ACTGATGGCGAGCTCAGACC 
 

 Reference information
 reference information 1
  Author
Satouh Y, Nozawa K, Ikawa M 
Title Sperm postacrosomal WW domain-binding protein is not required for mouse egg activation. 
Journal Biol Reprod 
Volume 93(4) 
Page 94 
Year 2015 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development