Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2139 
Type of strain Targeted mutant. 
Strain name C57BL/6N-Oosp1tm1a(KOMP)Osb/90 
Internal Code Oosp1 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Oosp1 
Gene name oocyte secreted protein 1 
Allele symbol Oosp1tm1a(KOMP)Osb/90 
Allele name oocyte secreted protein 1; targeted mutation 1a,Research Institute for Microbial Diseases, Osaka University 
MGI MGI:2149290 
Chromosome 19 (8.48) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer #5083  actgatggcgagctcagacc 
#5436  taaggatcaggcctacgata 
 
 Primer 2
  PCR Primer #5759  gtgccgaccactggttccatc 
#5760  gcactgttacagcacagcctctc 
 

 Reference information
 reference information 1
  Author
Ferheen Abbasi, Mayo Kodani, Chihiro Emori, Daiji Kiyozumi, Masashi Mori, Yoshitaka Fujihara, Masahito Ikawa. 
Title CRISPR/Cas9-Mediated Genome Editing Reveals Oosp Family Genes are Dispensable for Female Fertility in Mice. 
Journal Cells 
Volume 9(4) 
Page  
Year 2020 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development