Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2134 
Type of strain Targeted mutant. 
Strain name B6D2-Sp56tm1Osb 
Internal Code Sp56 KO 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Zp3r 
Gene name zona pellucida 3 receptor 
Allele symbol Zp3rtm1 
Allele name zona pellucida 3 receptor, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:104965 
Chromosome 1 (56.89) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer #3878  GCCATATGGCATCCACATTTGG 
#3881  CCATCTGACCTTTTGGTAGGCTC 
 
 Primer 2
  PCR Primer #2726  CTTTACGGTATCGCCGCTCCCGATT 
 

 Reference information
 reference information 1
  Author
Muro Y, Buffone MG, Okabe M, Gerton GL. 
Title Function of the acrosomal matrix: zona pellucida 3 receptor (ZP3R/sp56) is not essential for mouse fertilization. 
Journal Biol Reprod. 
Volume 86(1) 
Page 1-6 
Year 2012 
PMID