Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
2130 
Type of strain Targeted mutant.
Transgenic. 
Strain name B6D2-Calr3tm1Osb Tg(Calr3-Calr3)Osb 
Internal Code Calr3 TG 
Submitter Ikawa Masahito  
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Calr3 
Gene name calreticulin 3 
Allele symbol Calr3tm1Osb 
Allele name calreticulin 3; targeted mutation 1, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:1920566 
Chromosome 8 (35.08) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Gene information 2
  Gene symbol
Calr3 
Gene name calreticulin 3  
Allele symbol Tg(Calr3-Calr3)Osb 
Allele name calreticulin 3; transgene insertion, Research Institute for Microbial Diseases, Osaka University 
MGI MGI:1920566 
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer 1177  TTCTGGTCCAGGTCAGACGG 
1402  ctatcgattcccgtcggccaccgcgctc 
 

 Reference information
 reference information 1
  Author
Ikawa M, Tokuhiro K, Yamaguchi R, Benham AM, Tamura T, Wada I, Satouh Y, Inoue N, Okabe M. 
Title Calsperin is a testis-specific chaperone required for sperm fertility 
Journal J Biol Chem 
Volume 286(7) 
Page 5639-46 
Year 2011 
PMID