Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2075 
Type of strain Inbred.
Spontaneous/Chemical induced mutant. 
Strain name C57BL/6-Sh2d1arpl 
Internal Code C57BL/6.sap-/sap- 
Submitter Ono Masao 
Submitter affiliation or code Department of Pathology, Tohoku University Graduate School of Medicine 
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Tohoku University Graduate School of Medicine 
Organization code  
Developer Masao Ono 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Sh2d1a 
Gene name SH2 domain containing 1A 
Allele symbol  
Allele name  
MGI MGI:1328352 
Chromosome X (23.20) 
Gene classification Other gene(mutant etc.) 
Method  
OMIM
 
 Gene information 2
  Gene symbol
 
Gene name  
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Other gene(mutant etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer mSAP-1  GAGAAGCTCTTACTCGGTA 
mSAP-2  CCACTACCACGAGATATACT 
 

 Reference information
 reference information 1
  Author
Hiroaki Komori, Hiroshi Furukawa, Shiro Mori, Mitsuko R. Ito, Miho Terada, 
Title A Signal Adaptor SLAM-Associated Protein Regulates 
Journal J Immunol 
Volume 176 
Page 395–400 
Year 2006 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Genetics, Laboratory-animal Science