Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2074 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Gad1-Cre) 
Internal Code GAD67(Gad1)-Cre transgenic mouse 
Submitter Tamamaki Nobuaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions Other conditions. 
If you use GAD67(Gad1)-Cre mouse, please contact Prof. Kenji Sakimura for MTA. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Brain Research Institute, Niigata University 
Organization code  
Developer Prof.Kenji Sakimura 
Year introduced January 2009  
Introduced 
Generation
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gad1  
Gene name Glutamate decarboxylase 1  
Allele symbol Tg(Gad1-Cre) 
Allele name transgene insertion 
MGI  
Chromosome 2  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Cre F 9  ACGGCAAGCTGACCCTGAAG 
Cre R  CTTGTGCCCCAGGATGTTGC 
 

 Reference information
 reference information 1
  Author
Higo S, Akashi K, Sakimura K, Tamamaki N. 
Title Subtypes of GABAergic neurons project axons in the neocortex. 
Journal Front Neuroana 
Volume Nov 9;3:25  
Page  
Year 2009 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology, Development, Molecular biology, Behavior