Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2073 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(CAG-lox-mRFP-lox-GFP)18-43Tama 
Internal Code CAG-lox-mRFP-lox GFP double reporter mouse 
Submitter Tamamaki Nobuaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Dept of Morphological Neural Science. Grad Sch of Medical Sciences, Kumamoto Univ. 
Organization code Tama 
Developer Nobuaki Tamamaki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks This mice keep homozygote. 
 
 Gene information
 Gene information 1
  Gene symbol
GFP 
Gene name Green fluorescent protein 
Allele symbol (CAG-lox-mRFP-lox-GFP) 
Allele name transgene insertion, Nobuaki Tamamaki, Department of Morphological Brain Science, Graduate School of Medicine, Kyoto University  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer CGGCAAGCTGACCCTGAAG  CTTGTGCCCCAGGATGTTGC 
 

 Reference information
 reference information 1
  Author
Tanahira C, Higo S, Watanabe K, Tomioka R, Ebihara S, Kaneko T, Tamamaki N. 
Title Parvalbumin neurons in the forebrain as revealed by parvalbumin-Cre transgenic mice. 
Journal Neurosci Res. 
Volume Mar;63(3) 
Page 213-23 
Year 2009  
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Osteosis, Dentistry, Otorhinology, Hematology, Digestive Disorders, Reproduction, Metabolism, Endocrine Disorders, Neurobiology, Cell biology, Laboratory-animal Science, Development, Molecular biology, Aging, Anatomy