Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2055 
Type of strain Transgenic. 
Strain name C57Bl/6-Tg(Alb-EGFP) 
Internal Code Alb-GFP Tg mouse 
Submitter Miura Naoyuki 
Submitter affiliation or code Hamamatsu University School of Medicine 
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Hamamatsu University School of Medicine 
Organization code  
Developer Naoyuki Miura M.D, Ph.D. 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
EGFP 
Gene name Enhanced Green Fluorescent Protein 
Allele symbol Tg(Alb-EGFP) 
Allele name transgene insertion 
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer 820 (EDFP)  GACACGCYGAACTTGTGG 
826 (Alb promoter)  TTTGTAATGGGGTAGGAACC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Digestive Disorders, Cell biology, Development