Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2054 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Tbx1-AmCyan1) 
Internal Code Tbx1-AmCyan1 Tg mouse 
Submitter Miura Naoyuki 
Submitter affiliation or code Hamamatsu University School of Medicine 
Stock Type  
Material Transfer Conditions In the following cases, you do not need to be in contact. 
The following paper should be cited. Kimura W, Sharkar MTK, Sultana N, Islam MJ, Uezato T, *Miura N: Generation and characterization of Tbx1-AmCyan1 transgenic reporter mouse line that selectively labels developing thymus primordium. Transgenic Res 22: 659-666, (2013). 
Production method In-house breading.
 
Origin
(In-house)
Organization Hamamatsu University School of epicene 
Organization code  
Developer Naoyuki Miura M.D., Ph.D. 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
AmCyan1 
Gene name Amcyan1 
Allele symbol Tg(Tbx1-AmCyan1) 
Allele name transgene insertion 
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer PL45  GGAACCCTTCGAAGTTCCTA 
Tbx1HA2R  ACGTAAGCTTTTGGCCACTTTGATGGTGTT 
 

 Reference information
 reference information 1
  Author
Kimura W, Sharkar MTK, Sultana N, Islam MJ, Uezato T, Miura N 
Title Generation and characterization of Tbx1-AmCyan1 transgenic reporter mouse line that selectively labels developing thymus primordium. . 
Journal Transgenic Res  
Volume 22 
Page 659-666 
Year 2013 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development