Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2027 
Type of strain Targeted mutant. 
Strain name C57BL/6-Cdh2tm2 
Internal Code Ncad GDmutant 
Submitter Kinoshita Ayae 
Submitter affiliation or code Kyoto University Graduate School of Medicine Department of Human Health Sciences 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kyoto University Graduate School of Medicine Department of Human Health Sciences 
Organization code  
Developer Kinoshita Ayae 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cdh2 
Gene name Cadherin2 
Allele symbol Cdh2tm2 
Allele name cadherin2, targeted mutation 2, Ayae Kinoshita, Kyoto University 
MGI MGI:88355 
Chromosome 18 (10.1) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer CDH2 GD-Fw  CCACTTCTAAGCATGCAGGT 
CDH2 GD-Rv  AATGACTCCTATTTGAGCACA 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Cell biology, Laboratory-animal Science, Molecular biology, Behavior