Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1997 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Gsh2-iCre)/Tama 
Internal Code C57BL/6-Tg(Gsh2-iCre)/Tama 
Submitter Tamamaki Nobuaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions Other conditions. 
If you use Gsh2-iCre mouse, please contact Dr.Kesarris Nicoletta for MTA. 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Wolfson Institute for Biomedical Research University College London 
Organization code  
Developer Dr.Kesarris Nicoletta 
Year introduced December 2009  
Introduced 
Generation
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Gsh2 synonym of Gsx2 
Gene name Genomic Screened homeobox 2 (Gsh2
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer iCre 250s F  GAGGGACTACCTCCTGTACC 
iCre 800s R  TGCCCAGAGTCATCCTTGGC 
 

 Reference information
 reference information 1
  Author
Fogarty M, Grist M, Gelman D, Marín O, Pachnis V and Kessaris N.  
Title Spatial genetic patterning of the neuroepithelium generates GABAergic interneuron diversity in the adult cortex 
Journal Journal of Neuroscience 
Volume 27(41) 
Page 10935-46 
Year 2007 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Development, Molecular biology, Behavior