Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference 
 Strain information
  CARD ID
1973 
Type of strain Targeted mutant. 
Strain name C57BL/6-Tbxa2r tm1Sna 
Internal Code TPKO 
Submitter Narumiya Shuh 
Submitter affiliation or code Innovation Center for Immunoregulation Technologies and Drugs, Kyoto University Graduate School of Medicine 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Kyoto University Graduate School of Medicine, Department of pharmacology 
Organization code Sna 
Developer Shuh Narumiya 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Tbxa2r 
Gene name thromboxane A2 receptor 
Allele symbol Tbxa2rtm1Sna 
Allele name thromboxane A2 receptor, targeted mutation 1, Shuh Narumiya, Kyoto University 
MGI MGI:98496 
Chromosome 10 (39.72) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer ML136  AAGCTTGGGTTTCAGGGACCTG 
ML139  ACTTTGTTGCAGACACCACCTGTC 
 
 Primer 2
  PCR Primer ML136  AAGCTTGGGTTTCAGGGACCTG 
Neo2  TGATATTGCTGAAGAGCTTGGCGGCGAA 
 

 Reference information
 reference information 1
  Author
Kabashima K et al. 
Title Nat Immunol 
Journal Thromboxane A2 modulates interaction of dendritic cells and T cells and regulates acquired immunity 
Volume
Page 694-701 
Year 2003 
PMID