Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1946 
Type of strain Gene trap. 
Strain name MSM/Ms-FtoGt(pU-21MT)48Card 
Internal Code Ayu21-MT48 
Submitter Araki Kimi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, Kumamoto University 
Organization code Card 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fto 
Gene name fat mass and obesity associated 
Allele symbol  
Allele name  
MGI MGI:1347093 
Chromosome 8  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Reference information
 reference information 1
  Author
Mai Nakahara, et al. 
Title Gene-trap mutagenesis using Mol/MSM-1 embryonic stem cells from MSM/Ms mice. 
Journal Mamm. Genome 
Volume 24 (5-6) 
Page 228-239 
Year 2013 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-MT48