Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1933 
Type of strain Targeted mutant. 
Strain name C57BL/6-Rpt3tm1 
Internal Code Rpt3 delta 
Submitter Takahashi Ryosuke 
Submitter affiliation or code Department of Neurology kyoto University Graduate School of Medicine 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Department of Neurology kyoto University Graduate School of Medicine 
Organization code  
Developer Yoshitaka Tashiro , Ryousuke Takahashi 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Psmc4 
Gene name proteasome (prosome, macropain) 26S subunit, ATPase, 4 
Allele symbol Psmc4tm1 
Allele name targeted mutation 1 
MGI MGI:1346093 
Chromosome 7 (16.11) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer Rpt3fl-for  TGAGCTGTGTATCAAGGTCC 
Rpt3del-rev  TGCAATCCCTTGTCAGGAGA 
 

 Reference information
 reference information 1
  Author
Tashiro Y, Urushitani M, Inoue H, Koike M, Uchiyama Y, Komatsu M, Tanaka K, Yamazaki M, Abe M, Misawa H, Sakimura K, Ito H, Takahashi R. 
Title Motor Neuron-specific Disruption of Proteasomes, but not Autophagy, Replicates Amyotrophic Lateral Sclerosis. 
Journal J Biol Chem. 
Volume  
Page PMID: 23095749 
Year 2012 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Osteosis, Dentistry, Otorhinology, Hematology, Digestive Disorders, Reproduction, Metabolism, Endocrine Disorders, Neurobiology, Dermatology, peromelia, Urology, cancer, infectious, Diabetes, Obesity, Chromosome aberration, Immunology, Genetics, Cell biology, Laboratory-animal Science, Development, Molecular biology, Pharmacology, Behavior, Aging, Anatomy, Physiology, Respiratory System