Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1897 
Type of strain Transgenic. 
Strain name B6-Tg(Tyr-CRE)Lru 
Internal Code Tyr-Cre 
Submitter Kato Masashi 
Submitter affiliation or code Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Institut Curie 
Organization code Lru 
Developer Lionel Larue 
Year introduced September 2007  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cre 
Gene name Cre recombinase 
Allele symbol  
Allele name  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM OMIM ID: 611458
Human Gene Symbol: GLB1

 
 Primer 1
  PCR Primer pr0347  GTCACTCCAGGGGTTGCTGG 
pr0348  CCGCCGCATAACCAGTGA 
 

 Reference information
 reference information 1
  Author
Delmas V, Martinozzi S, Bourgeois Y, Holzenberger M, Larue L. 
Title Cre-mediated recombination in the skin melanocyte lineage. 
Journal  
Volume  
Page  
Year  
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Ophthalomology, Otorhinology, Dermatology, cancer, Cell biology, Laboratory-animal Science, Development, Molecular biology, Aging 
  OMIM OMIM ID: 611458
Human Gene Symbol: GLB1
Allelic Variant Name :
GM1-GANGLIOSIDOSIS, TYPE III
MORQUIO SYNDROME B
GM1-GANGLIOSIDOSIS, TYPE I
GM1-GANGLIOSIDOSIS, TYPE II
GM1-GANGLIOSIDOSIS, TYPE I, WITH CARDIAC INVOLVEMENT