Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1896 
Type of strain Transgenic. 
Strain name B6;BALB-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges) 
Internal Code B6;BALB-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges), K19-Wnt1/C2mE(B6;BALB) 
Submitter Masanobu Oshima 
Submitter affiliation or code Division of Genetics, Cancer Research Institute, Kanazawa University 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Cancer Research Institute, Kanazawa Univ. 
Organization code  
Developer Masanobu Oshima 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Wnt1, Ptgs2, Ptges 
Gene name wingless-type MMTV integration site family, member 1; prostaglandin-endoperoxide synthase 2; prostaglandin E synthase  
Allele symbol  
Allele name  
MGI MGI:98953 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM OMIM ID: 164820
Human Gene Symbol: WNT1

OMIM ID: 600262
Human Gene Symbol: PTGS2

OMIM ID: 605172
Human Gene Symbol: PTGES

 
 Primer 1
  PCR Primer Wnt1F,COX-2-F3  CGACCGTGTTCTCTGAGATG,CAAACTCAAGTTTGACCCAG 
HA-R,COX-2-R1  CATCATATGGGTAGGCCATGG,CTTTTACAGCTCAGTTGAACG 
 

 Reference information
 reference information 1
  Author
Oshima H, Matsunaga A, Fujimura T, Tsukamoto T, Taketo MM, Oshima M. 
Title Carcinogenesis in mouse stomach by simultaneous activation of the wnt signaling and prostaglandin e(2) pathway. 
Journal Gastroenterology 
Volume 131 
Page 1086-1095 
Year 2006 
PMID  
 
 reference information 2
  Author
Oshima H, Oguma K, Du YC and Oshima M 
Title Prostaglandin E2, Wnt, and BMP in gastric tumor mouse models. 
Journal Cancer Science 
Volume 100 (10) 
Page 1779-1785 
Year 2009 
PMID  
 
 reference information 3
  Author
Oshima H and Oshima M 
Title Mouse models of gastric tumors: Wnt activation and PGE2 induction. 
Journal Pathology International 
Volume 60 (9) 
Page 599-607 
Year 2010 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
cancer 
  OMIM OMIM ID: 164820
Human Gene Symbol: WNT1

OMIM ID: 600262
Human Gene Symbol: PTGS2

OMIM ID: 605172
Human Gene Symbol: PTGES