Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1895 
Type of strain Transgenic. 
Strain name FVB-Tg(hPRSS8)47870/Card 
Internal Code FVB Tg hPRSS8-47870 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization Department of Molecular Biology and Microbiology, and Biomolecular Science Center, University of Central Florida, Orlando, Florida 
Organization code  
Developer Karl X. Chai 
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
hPRSS8 
Gene name human prostasin 
Allele symbol  
Allele name transgene insertion, Karl X. , Department of Molecular Biology and Microbiology, and Biomolecular Science Center, University of Central Florida 
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer H. pro-rat-kpnl-s  5CTCCTCCAACTCAGCAGACC 
Human PRSS8 RT-PCR-A  5GAGAGATGTGCTCATCAGTCTGG 
 

 Reference information
 reference information 1
  Author
Li-Mei Chen, Cindy Wang, Mengqian Chen, Matthew R. Marcello, Julie Chao, Lee Chao and Karl X. Chai 
Title Prostasin attenuates inducible nitric oxide synthase expression in lipopolysaccharide-induced urinary bladder inflammation 
Journal Am J Physiol Renal Physiol 
Volume 291 
Page F567-F577 
Year 2006 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Unknown