Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1838 
Type of strain Targeted mutant. 
Strain name B6-Mir142tm1Card 
Internal Code 21-KBW111reKO17 
Submitter Masatake ARAKI 
Submitter affiliation or code Gene Technology Center, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code Card 
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Mir142 
Gene name microRNA 142 
Allele symbol  
Allele name  
MGI MGI:2676827 
Chromosome 11 (52.21) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Reference information
 reference information 1
  Author
Tanaka, K., et al. 
Title MiR-142 is required for Staphylococcus aureus clearance at skin wound sites via small GTPase-mediated regulation of the neutrophil actin cytoskeleton. 
Journal J. Invest, Dermatol. 
Volume 137 
Page 931-940 
Year 2017 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Hematology, Dermatology, Immunology, Development