Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Disease,Applicable field 
 Strain information
Type of strain Gene trap. 
Strain name B6;B6D2-Gpr172bGt(LTOCG)08Osb 
Internal Code LTOCG-08:Gpr172b 
Submitter kikutani hitoshi 
Submitter affiliation or code Research Institute for Microbial Diseases 
Stock Type  
Material Transfer Conditions Other conditions. 
The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. 
Production method In-house breading.
Organization Research Institute for Microbial Diseases, Osaka University 
Organization code Osb 
Developer Masahito Ikawa 
(From other organizations)
Organization code  
Year introduced  
 Gene information
 Gene information 1
  Gene symbol
Gene name G protein-coupled receptor 172B  
Allele symbol  
Allele name  
MGI MGI:1289288 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Other 
 Primer 1
  PCR Primer 4135  gatctctagttaccagagtcac 
ARC07-02-10  acttgaactcgggaccctcagaa 

 Disease , Applicable field information
  Disease name,
Applicable field