Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1681 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(T1r3-WGA-GFP)M1Abek 
Internal Code TIR3-WiG 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Graduate School of Agricultural and Life Sciences, The University of Tokyo 
Organization code
Developer Keiko Abe 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
WGA, GFP 
Gene name wheat germ agglutinin, green fluorescent protein 
Allele symbol Tg(T1r3-WGA-GFP)M1Abek 
Allele name transgene insertion M1, Keiko Abe 
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer EGFP-F1  atg g tgagcaagggcgaggagctgttcacc 
EGFP-R1  cttgtacagctcgtccatgccgagagtga 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Anatomy, Physiology