Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes 
 Strain information
  CARD ID
1425 
Type of strain Transgenic. 
Strain name B6.C3-Tg(CAG-mRFP)3Kwk 
Internal Code CLR 
Submitter KAWAKAMI KIYOSHI 
Submitter affiliation or code jichi medical university 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Div.Biology, Center for Molecular Medicine, Jichi Medical University 
Organization code  
Developer Kiyoshi Kawakami 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
mRFP 
Gene name red fluorescent protein 
Allele symbol Tg(CAG-mRFP)3Kwk 
Allele name transgene insertion 3, Kiyoshi Kawakami 
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer LSL-S  AACAACGGCGGCTACAACGGTGG 
mRFP1-AS  GGTCTGGGTGCCCTCGTAG