Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1301 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(T1r3-WGA)273M2Abek 
Internal Code Tg(T1r3-WGA)273M2Abek 
Submitter - - 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Graduate Shool of Agricultural and Life Sciences, The University of Tokyo 
Organization code
Developer Keiko Abe 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
WGA 
Gene name wheat germ agglutinin 
Allele symbol Tg(T1r3-WGA)273M2Abek 
Allele name transgene insertion 273M2, Keiko Abe 
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer T1R3-F1  AGCAGAACAGCTGAGACCCTTGC 
WGA-R1  CGTAAGGGCCATGGTGCTCATCATCTTTCT 
 

 Reference information
 reference information 1
  Author
Makoto Ohmoto , Ichiro Matsumoto , Akihito Yasuoka , Yoshihiro Yoshihara , Keiko Abe 
Title Genetic tracing of the gustatory and trigeminal neural pathways originating from T1R3-expressing taste receptor cells and solitary chemoreceptor cells 
Journal Molecular and Cellular Neuroscience 
Volume 38 
Page 505–517 
Year 2008 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Anatomy, Physiology