Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1258 
Type of strain Gene trap. 
Strain name B6-Tcf12Gt(21-KBW)60Card 
Internal Code Ayu21-KBW60 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Laboratory of Developmental Genetics, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, kumamoto University 
Organization code  
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Tcf12 
Gene name transcription factor 12 
Allele symbol  
Allele name  
MGI MGI:101877 
Chromosome 9  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0006350 transcription IEA
GO:0005634 nucleus IEA
GO:0045449 regulation of transcription IEA
GO:0007275 multicellular organismal development IEA
GO:0030528 transcription regulator activity IEA
GO:0005515 protein binding IPI
GO:0005667 transcription factor complex IDA
GO:0003677 DNA binding IDA
GO:0016563 transcription activator activity IDA
GO:0006357 regulation of transcription from RNA polymerase II promoter IDA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0006350 transcription IEA
GO:0005634 nucleus IEA
GO:0045449 regulation of transcription IEA
GO:0007275 multicellular organismal development IEA
GO:0030528 transcription regulator activity IEA
GO:0005515 protein binding IPI
GO:0005667 transcription factor complex IDA
GO:0003677 DNA binding IDA
GO:0016563 transcription activator activity IDA
GO:0006357 regulation of transcription from RNA polymerase II promoter IDA
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-KBW60