Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1249 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(NEU3)1Myg 
Internal Code C57BL/6-Tg(NEU3)/Myg 
Submitter Yamaguchi Kazunori 
Submitter affiliation or code Molecular and Cellular Oncology, Miyagi Cancer Center Research 
Stock Type  
Material Transfer Conditions Other conditions. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Miyagi Cancer Center Research Institute, Division of Biochemistry 
Organization code Myg 
Developer Taeko Miyagi 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
NEU3 
Gene name neuraminidase 3 
Allele symbol Tg(NEU3)1Myg 
Allele name transgene insertion 1, Taeko Miyagi 
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer MT15  GACTGGTCATCCCTGCGTAT 
MT16  CACCTATGTGGGATCTCCAG 
 

 Reference information
 reference information 1
  Author
Akinori Sasaki, Keiko Hata, Susumu Suzuki, Masashi Sawada, Tadashi Wada, Kazunori Yamaguchi, Masuo Obinata, Hiroo Tateno, Hiroshi Suzuki, and Taeko Miyagi 
Title Overexpression of Plasma Membrane-associated Sialidase Attenuates Insulin Signaling in Transgenic Mice 
Journal J. Biol. Chem. 
Volume 278 
Page 27896 
Year 2003 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, cancer, Immunology, Physiology