Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1241 
Type of strain Gene trap. 
Strain name B6-PtprgGt(Ayu21-KBW)75Card 
Internal Code Ayu21-KBW75 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Laboratory of Developmental Genetics, Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, kumamoto University 
Organization code  
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ptprg 
Gene name protein tyrosine phosphatase,receptor type,G 
Allele symbol  
Allele name  
MGI MGI:97814 
Chromosome 14 (chr14:12,370,000-13,100,000) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0016787 hydrolase activity IEA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0004721 phosphoprotein phosphatase activity IEA
GO:0016311 dephosphorylation IEA
GO:0006470 protein amino acid dephosphorylation IEA
GO:0004725 protein tyrosine phosphatase activity IEA
GO:0016791 phosphatase activity IEA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0016787 hydrolase activity IEA
GO:0016021 integral to membrane IEA
GO:0016020 membrane IEA
GO:0004721 phosphoprotein phosphatase activity IEA
GO:0016311 dephosphorylation IEA
GO:0006470 protein amino acid dephosphorylation IEA
GO:0004725 protein tyrosine phosphatase activity IEA
GO:0016791 phosphatase activity IEA
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-KBW75