Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1233 
Type of strain Gene trap. 
Strain name BDF1-Ints8Gt(1)LG01Osb  
Internal Code B6D2F1-Ints8  
Submitter kikutani hitoshi 
Submitter affiliation or code Research Institute for Microbial Diseases 
Stock Type  
Material Transfer Conditions Other conditions. 
The RECIPIENT must the DEPOSITOR in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. 
Production method In-house breading.
 
Origin
(In-house)
Organization Research Institute for Microbial Diseases, Osaka University 
Organization code Osb 
Developer Yuka Morioka, Masahito Ikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Ints8 
Gene name integrator complex subunit 8 
Allele symbol  
Allele name  
MGI MGI:1919906 
Chromosome  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Other 
GO
GO ID GO Term GO Evidence Code
GO:0005634 nucleus IEA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0005634 nucleus IEA
 
 Primer 1
  PCR Primer 4135  GATCTCTAGTTACCAGAGTCA 
4164  CTCAGCTCTCCAAGGGGTTGTATTG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown