Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1175 
Type of strain Targeted mutant. 
Strain name C.129-Mta2tm1 
Internal Code
Submitter Okamura Takeshi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization National Kyushu Cancer Center 
Organization code  
Developer Soichi Takiguchi 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Mta2 
Gene name Metastasis-associated gene 2 
Allele symbol Mta2 
Allele name targeted mutation 1 
MGI MGI:1346340 
Chromosome 19 (B ) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Mtal/2ml  TAGCTTTACGGAGCCCTGGCGCTCG 
Mta2-com  CAGGAAGCACAAAGTCGGCACTGC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown