Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1104 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(Calretinin-Cre)6 
Internal Code Calretinin-Cre #6 
Submitter Tamamaki Nobuaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Dept of Morphological Neural Science, Grad. Sch. of MEd., Kumamoto Univ. 
Organization code  
Developer Nobuaki Tamamaki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks Need contact to Nobuaki Tamamaki (tamamaki@kumamoto-u.ac.jp) Need acknowledgement in case of publication 
 
 Gene information
 Gene information 1
  Gene symbol
Cre 
Gene name Cre recombinase 
Allele symbol Tg(Calretinin-Cre)6 
Allele name transgene insertion  
MGI  
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer nlsCre-up  ATGTCCAATTTACTGACCGT 
Cre-low  CCGCATAACCAGTGAAACAG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, Development