Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
787 
Type of strain Transgenic. 
Strain name Tg(PrP delta preOR) 
Internal Code Tg(PrP delta preOR) 
Submitter YOSHIKAWA DAISUKE 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method
 
Origin
(In-house)
Organization Departmennto of Molecular Microbiology and Immunology 
Organization code Ngs 
Developer Daisuke Yoshikawa 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Prnp &Delta preOR 
Gene name Prnp &Delta preOR 
Allele symbol  
Allele name  
MGI  
Chromosome  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM
 
 Primer 1
  PCR Primer SHa-forward  gcgtgctggacaatgacgtg 
del-reverse  ggttggtttttggtttgctg 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Unknown