Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1198 
Type of strain Gene trap. 
Strain name B6;CB-Odz4Gt(pU-21W)81Imeg 
Internal Code Ayu21-W81 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics, Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Odz4 
Gene name odd Oz/ten-m homolog 4 (Drosophila) 
Allele symbol  
Allele name  
MGI MGI:2447063 
Chromosome 7  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0016021 integral to membrane IEA
GO:0001702 gastrulation with mouth forming second IMP
GO:0016020 membrane IEA
GO:0007165 signal transduction IEA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0016021 integral to membrane IEA
GO:0001702 gastrulation with mouth forming second IMP
GO:0016020 membrane IEA
GO:0007165 signal transduction IEA
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-W81