Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1179 
Type of strain Gene trap. 
Strain name B6;CB-Fkbp4Gt(pU-21W)74Imeg 
Internal Code Ayu21-W74 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Molecular Embryology and Genetics Kumamoto University 
Organization code Imeg 
Developer Kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Fkbp4 
Gene name FK506 binding protein 4 
Allele symbol  
Allele name  
MGI MGI:95543 
Chromosome 6  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0005737 cytoplasm IEA
GO:0016853 isomerase activity IEA
GO:0003755 peptidyl-prolyl cis-trans isomerase activity IEA
GO:0005488 binding IEA
GO:0005634 nucleus IDA
GO:0005524 ATP binding IDA
GO:0005525 GTP binding IDA
GO:0007566 embryo implantation IMP
GO:0006457 protein folding IEA
GO:0006463 steroid hormone receptor complex assembly IDA
more... (Total Hit Count: 18)
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0005737 cytoplasm IEA
GO:0016853 isomerase activity IEA
GO:0003755 peptidyl-prolyl cis-trans isomerase activity IEA
GO:0005488 binding IEA
GO:0005634 nucleus IDA
GO:0005524 ATP binding IDA
GO:0005525 GTP binding IDA
GO:0007566 embryo implantation IMP
GO:0006457 protein folding IEA
GO:0006463 steroid hormone receptor complex assembly IDA
more... (Total Hit Count: 18)
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-W74