Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2247 
Type of strain Transgenic. 
Strain name C57BL/6-Tg(CAG-LSL-Spink3)1Card 
Internal Code CAG promoter-LSL-Spink3 line 1 
Submitter Ohmuraya Masaki 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Institute of Resource Development and Analysis, Kumamoto University 
Organization code Card 
Developer Masaki Ohmuraya 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Spink3 
Gene name Serine protease inhibitor, Kazal type 3 
Allele symbol  
Allele name  
MGI MGI:106202 
Chromosome  
Gene classification Gene to express(transgenic) 
Method  
OMIM
 
 Primer 1
  PCR Primer mPsti5  TGTGTGGGACTGACGGAATTAC 
mPsti6  AGGACAGGCTCTATGCGTTTC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Digestive Disorders