|
CARD ID
 |
1933 |
Type of strain |
Targeted mutant. |
Strain name |
C57BL/6-Rpt3tm1 |
Internal Code |
Rpt3 delta |
Submitter |
Takahashi Ryosuke |
Submitter affiliation or code |
Department of Neurology kyoto University Graduate School of Medicine |
Stock Type |
|
Material Transfer Conditions |
It is necessary to consent to the submitter. |
Production method |
In-house breading. |
Origin (In-house) |
Organization |
Department of Neurology kyoto University Graduate School of Medicine |
Organization code |
|
Developer |
Yoshitaka Tashiro , Ryousuke Takahashi |
Origin (From other organizations) |
Organization |
|
Organization code |
|
Developer |
|
Year introduced |
|
Introduced Generation |
|
Remarks |
|
|
Gene symbol
 |
Psmc4 |
Gene name |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
Allele symbol |
Psmc4tm1 |
Allele name |
targeted mutation 1 |
MGI |
MGI:1346093 |
Chromosome |
7 (16.11) |
Gene classification |
Targeted or trapped gene(knockout etc.) |
Method |
MicroInjection |
OMIM |
|
|
|
PCR Primer |
Rpt3fl-for
|
TGAGCTGTGTATCAAGGTCC
|
Rpt3del-rev
|
TGCAATCCCTTGTCAGGAGA
|
|
reference information 1 |
|
Author
 |
Tashiro Y, Urushitani M, Inoue H, Koike M, Uchiyama Y, Komatsu M, Tanaka K, Yamazaki M, Abe M, Misawa H, Sakimura K, Ito H, Takahashi R. |
Title |
Motor Neuron-specific Disruption of Proteasomes, but not Autophagy, Replicates Amyotrophic Lateral Sclerosis. |
Journal |
J Biol Chem. |
Volume |
|
Page |
PMID: 23095749 |
Year |
2012 |
PMID
|
|
|
Disease , Applicable field information
|
|
Disease name, Applicable field
|
Ophthalomology, Osteosis, Dentistry, Otorhinology, Hematology, Digestive Disorders, Reproduction, Metabolism, Endocrine Disorders, Neurobiology, Dermatology, peromelia, Urology, cancer, infectious, Diabetes, Obesity, Chromosome aberration, Immunology, Genetics, Cell biology, Laboratory-animal Science, Development, Molecular biology, Pharmacology, Behavior, Aging, Anatomy, Physiology, Respiratory System
|
|
|