Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
1736 
Type of strain Targeted mutant. 
Strain name B6;Cg-Atg5tm1Myok Spink3tm1(cre)Imeg 
Internal Code Atg5 flox/-;Spink3-cre mouse 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization Institute of Resource Development and Analysis, Kumamoto university 
Organization code Card 
Developer Ken-ichi Yamamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Spink3 
Gene name serine peptidase inhibitor, Kazal type 3 
Allele symbol Spink3tm1(cre)Imeg 
Allele name serine peptidase inhibitor, Kazal type 3; targeted mutation 1, Institute of Molecular Embryology and Genetics 
MGI  
Chromosome 18 (23.47) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Gene information 2
  Gene symbol
Atg5 
Gene name autophagy-related 5 
Allele symbol Atg5tm1Myok 
Allele name autophagy-related 5; targeted mutation 1, Minesuke Yokoyama 
MGI  
Chromosome 10 (23.24) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer check2  acaacgtcgagcacagctgcgcaagg 
short2  gtactgcataatggtttaactcttgc 
 
 Primer 2
  PCR Primer exon3-1  gaatatgaaggcacacccctgaaatg 
 

 Reference information
 reference information 1
  Author
Hashimoto D, Ohmuraya M, Hirota M, Yamamoto A, Suyama K, Ida S, Okumura Y, Takahashi E, Kido H, Araki K, Baba H, Mizushima N, Yamamura K. 
Title Involvement of autophagy in trypsinogen activation within the pancreatic acinar cells. 
Journal J Cell Biol. 
Volume 181 
Page 1065-72 
Year 2008 
PMID  
 
 reference information 2
  Author
Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R, Yokoyama M, Mishima K, Saito I, Okano H, Mizushima N 
Title Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. 
Journal Nature 
Volume 441 
Page 885-9 
Year 2006 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Digestive Disorders