Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1526 
Type of strain Gene trap. 
Strain name 129P2/OlaHsd-Naa25Gt(pGT2lxf)RRK280Byg 
Internal Code p120-Naa25Gt(RRK280)Byg 
Submitter Akira Kakizuka 
Submitter affiliation or code Graduate School of Biostudies, Kyoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method From other organizations.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization University of California 
Organization code  
Developer  
Year introduced July 2009  
Introduced 
Generation
F1 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Naa25 
Gene name N(alpha)-acetyltransferase 25 
Allele symbol  
Allele name  
MGI MGI:2442563 
Chromosome 5  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer b-gal-forward-IGTG  TTATCGATGAGCGTGGTTATGC 
b-gal-reverse-IGTG  GCGCGTACATCGGGCAAATAATATC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Neurobiology, cancer