Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2385 
Type of strain Targeted mutant. 
Strain name BALB/c- Rag2tm1Jak3tm1Fahtm1 
Internal Code BRJ-Fah 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Center for Animal Resource and Development, Kumamoto University 
Organization code  
Developer Ken-ichi Yamamura 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks Maintenance and rearing with water containing NTBC (7.5mg/L). 
 
 Gene information
 Gene information 1
  Gene symbol
Rag2 
Gene name recombination activating gene 2 
Allele symbol Rag2tm1 
Allele name recombination activating gene 2, targeted mutation 1 
MGI MGI:97849 
Chromosome 2 (53.87) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Gene information 2
  Gene symbol
Jak3 
Gene name Janus Kinase 3 
Allele symbol Jak3tm1 
Allele name Janus Kinase 3, targeted mutation 1 
MGI MGI:99928 
Chromosome 8 (34.43) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method  
OMIM
 
 Gene information 3
  Gene symbol
Fah 
Gene name fumarylacetoacetate hydrolase 
Allele symbol Fah3tm1 
Allele name fumarylacetoacetate hydrolase, targeted mutation 1 
MGI MGI:95482 
Chromosome 7 (48.36) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer Fah-Fw  CTCTGCAGGAGACTACACGGACTTCTACTC 
Fah-Re  CCAATTTGGCAACAGCGCATTCTCCTTGCC 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Digestive Disorders, Urology, cancer, Laboratory-animal Science