Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes 
 Strain information
  CARD ID
2371 
Type of strain Targeted mutant. 
Strain name C57BL/6-Rbp4tm2(RBP4)Card 
Internal Code mRbp4hRBP4orf 
Submitter Yamamura Ken-ichi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization  
Organization code  
Developer  
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Rbp4 
Gene name retinol binding protein 4, plasma 
Allele symbol Rbp4tm1(RBP4)Card 
Allele name retinol binding protein 4, plasma, targeted mutation 1, 
MGI MGI:97879 
Chromosome 19 (32.75) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer GSPF1  CTCGGCTCCGTCGCTCCACG 
GSPR1  CCAGAGCCCAGAGAACTGAG