Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
2276 
Type of strain Targeted mutant. 
Strain name Balb/c-Hr,Rag-2tm1,Jak3tm1 
Internal Code Balb/c-R/J mice 
Submitter Unknown Unknown 
Submitter affiliation or code  
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Center for AIDS Research, Kumamoto University 
Organization code
Developer Seiji Okada 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Rag2 
Gene name recombination activating gene 2 
Allele symbol Rag2tm1 
Allele name recombination activating gene 2, targeted mutation 1, 
MGI MGI:97849 
Chromosome 2 (53.87) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Gene information 2
  Gene symbol
Jak3 
Gene name Janus kinase 3 
Allele symbol Jak3,sup>tm1 
Allele name Janus kinase 3, targeted mutation 1, 
MGI MGI:99928 
Chromosome 8 (34.43) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer am05 (viral LTR)  GCGTTACTGCAGCTAGCTTG 
am06 (Hr exon 6)  TGTAGCCTGTGGTCGCATAG 
am07 (Hr intron 6)  CTCCTGTTTGCTTGGTCATC 
 
 Primer 2
  PCR Primer Neo-3  CCAACGCTATGTCCTGATAGCGGT 
RG2-2  TTAATTCAACCAGGCTTCTCACTT 
RG2—3  GCCTGCTTATTGTCTCCTGGTATG 
 
 Primer 3
  PCR Primer Oligo1  CCA GAC CAG CAG AGG GAC TT 
Oligo2  GAA CCT GCG TGC AAT CCA TCT TG 
Oligo3  ACC CAG GTA CTC CAT GCC CT 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Dermatology, cancer, Immunology, Development, Anatomy, Physiology