Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field   - EGTC 
 Strain information
  CARD ID
1243 
Type of strain Gene trap. 
Strain name B6;CB-RalyGt(pU-21W)128Card 
Internal Code Ayu21-W128 
Submitter Ken-ichi YAMAMURA 
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization IRDA, kumamoto University 
Organization code  
Developer kimi Araki 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Raly 
Gene name hnRNP-associated with lethal yellow 
Allele symbol  
Allele name  
MGI MGI:97850 
Chromosome 2 (chr2:154,610,000-154,880,000) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
GO
GO ID GO Term GO Evidence Code
GO:0005634 nucleus IEA
GO:0030529 ribonucleoprotein complex IEA
GO:0005681 spliceosomal complex IEA
GO:0003723 RNA binding IEA
GO:0008380 RNA splicing IEA
GO:0006397 mRNA processing IEA
GO:0003676 nucleic acid binding IEA
GO:0000166 nucleotide binding IEA
OMIM
GO
GO ID GO Term GO Evidence Code
GO:0005634 nucleus IEA
GO:0030529 ribonucleoprotein complex IEA
GO:0005681 spliceosomal complex IEA
GO:0003723 RNA binding IEA
GO:0008380 RNA splicing IEA
GO:0006397 mRNA processing IEA
GO:0003676 nucleic acid binding IEA
GO:0000166 nucleotide binding IEA
 
 Primer 1
  PCR Primer Z-1  GCGTTACCCAACTTAATCG 
Z-2  TGTGAGCGAGTAACAACCCG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Development 
 
 Related imformation
  EGTC
21-W128