CARD R-BASE ( Mouse Strain Resource )

Center for Animal Resources and Development Database !

CARD

Home > Strains > Strain detail

Strain Detail

- Strains

- Genes

- Disease,Applicable field

Strain information

	CARD ID		781
	Type of strain		Transgenic.
	Strain name		B6;C3H-Tg(K19-Wnt5a/K19-Ptgs2/K19-Ptges)#5,7
	Internal Code		K19-Wnt5a/C2mE
	Submitter		Masanobu Oshima
	Submitter affiliation or code		Division of Genetics, Cancer Research Institute, Kanazawa University
	Stock Type
	Material Transfer Conditions		It is necessary to consent to the submitter.
	Production method		In-house breading.
	Origin (In-house)	Organization	Cancer Research Institute, Kanazawa Univ.
		Organization code
		Developer	Hiroko Oshima
	Origin (From other organizations)	Organization
		Organization code
		Developer
		Year introduced
		Introduced Generation
	Remarks

Gene information

Gene information 1

	Gene symbol		Wnt5a
	Gene name		wingless-related MMTV integration site 5A
	Allele symbol
	Allele name
	MGI		MGI:98958
	Chromosome		Unknown
	Gene classification		Gene to express(transgenic)
	Method		MicroInjection
	OMIM		OMIM ID: 164975 Human Gene Symbol: WNT5A

Gene information 2

	Gene symbol		Ptgs2
	Gene name		prostaglandin-endoperoxide synthase 2;
	Allele symbol
	Allele name
	MGI		MGI:97798
	Chromosome		Unknown
	Gene classification		Gene to express(transgenic)
	Method		MicroInjection
	OMIM		OMIM ID: 600262 Human Gene Symbol: PTGS2

Gene information 3

	Gene symbol		Ptges
	Gene name		prostaglandin E synthase
	Allele symbol
	Allele name
	MGI		MGI:1927593
	Chromosome		Unknown
	Gene classification		Gene to express(transgenic)
	Method		MicroInjection
	OMIM		OMIM ID: 605172 Human Gene Symbol: PTGES

Primer 1

	PCR Primer	Wnt5a-F	AGCAGGCCGTAGGACAGTAT
		HA-R	CATCATATGGGTAGGCCATGG

Disease , Applicable field information

	Disease name, Applicable field	cancer, Development
	OMIM	OMIM ID: 164975 Human Gene Symbol: WNT5A OMIM ID: 600262 Human Gene Symbol: PTGS2 OMIM ID: 605172 Human Gene Symbol: PTGES