Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
781 
Type of strain Transgenic. 
Strain name B6;C3H-Tg(K19-Wnt5a/K19-Ptgs2/K19-Ptges)#5,7 
Internal Code K19-Wnt5a/C2mE 
Submitter Masanobu Oshima 
Submitter affiliation or code Division of Genetics, Cancer Research Institute, Kanazawa University 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Cancer Research Institute, Kanazawa Univ. 
Organization code  
Developer Hiroko Oshima 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Wnt5a 
Gene name wingless-related MMTV integration site 5A 
Allele symbol  
Allele name  
MGI MGI:98958 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM OMIM ID: 164975
Human Gene Symbol: WNT5A

 
 Gene information 2
  Gene symbol
Ptgs2 
Gene name prostaglandin-endoperoxide synthase 2;  
Allele symbol  
Allele name  
MGI MGI:97798 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM OMIM ID: 600262
Human Gene Symbol: PTGS2

 
 Gene information 3
  Gene symbol
Ptges 
Gene name prostaglandin E synthase 
Allele symbol  
Allele name  
MGI MGI:1927593 
Chromosome Unknown  
Gene classification Gene to express(transgenic) 
Method MicroInjection 
OMIM OMIM ID: 605172
Human Gene Symbol: PTGES

 
 Primer 1
  PCR Primer Wnt5a-F  AGCAGGCCGTAGGACAGTAT 
HA-R  CATCATATGGGTAGGCCATGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
cancer, Development 
  OMIM OMIM ID: 164975
Human Gene Symbol: WNT5A

OMIM ID: 600262
Human Gene Symbol: PTGS2

OMIM ID: 605172
Human Gene Symbol: PTGES