CARD R-BASE ( Mouse Strain Resource )

Center for Animal Resources and Development Database !

CARD

Home > Strains > Strain detail

Strain Detail

- Strains

- Genes

- Reference

- Disease,Applicable field

Strain information

	CARD ID		2140
	Type of strain		Targeted mutant.
	Strain name		C57BL/6N-Wbp2nl^{tm1a(EUCOMM)Osb}
	Internal Code		PAWP KO
	Submitter		Ikawa Masahito
	Submitter affiliation or code		Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
	Stock Type
	Material Transfer Conditions		It is necessary to consent to the submitter.
	Production method		In-house breading.
	Origin (In-house)	Organization	Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
		Organization code	Osb
		Developer	Masahito Ikawa
	Origin (From other organizations)	Organization
		Organization code
		Developer
		Year introduced
		Introduced Generation
	Remarks

Gene information

Gene information 1

	Gene symbol		Wbp2nl
	Gene name		WBP2 N-terminal like
	Allele symbol		Wbp2nl^{tm1b(EUCOMM)Osb}
	Allele name		WBP2 N-terminal like, targeted mutation 1b, Research Institute for Microbial Diseases,Osaka University
	MGI		MGI:1921966
	Chromosome		15 (38.56)
	Gene classification		Targeted or trapped gene(knockout etc.)
	Method		Electroporation
	OMIM

Primer 1

	PCR Primer	#5438	GCTTCCTCTGGCTTGCTCAGCTTGCTTTC
		#5083	ACTGATGGCGAGCTCAGACC

Reference information

reference information 1

	Author	Satouh Y, Nozawa K, Ikawa M
	Title	Sperm postacrosomal WW domain-binding protein is not required for mouse egg activation.
	Journal	Biol Reprod
	Volume	93(4)
	Page	94
	Year	2015
	PMID

Disease , Applicable field information

Disease name,
Applicable field

Development