Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Disease,Applicable field 
 Strain information
  CARD ID
1688 
Type of strain Targeted mutant. 
Strain name B6.129-Cckartm1 
Internal Code C57BL/6-Cckartm1 
Submitter Okamura Takeshi 
Submitter affiliation or code
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization National Kyushu Cancer Center 
Organization code  
Developer Soich Takiguchi 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Cckar 
Gene name Cholecystokinin A receptor 
Allele symbol Cckartm1 
Allele name Cholecystokinin A receptor; targeted mutation 1, Soichi Takiguchi 
MGI  
Chromosome 5 (29.52) 
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
OMIM
 
 Primer 1
  PCR Primer CCKA-1  AGTGAGCCATTCACCAGCTCGCCAG 
LacZ-1  CGCTATTACGCCAGCTGGCGAAAGG 
 

 Disease , Applicable field information
  Disease name,
Applicable field
Metabolism, Neurobiology, cancer, Physiology