Center for Animal Resources and Development Database ! Home About CARD  
Strains
Genes
Reference
Disease
Download
Distribution
Home > Strains > Strain detail

Strain Detail


 - Strains   - Genes   - Reference   - Disease,Applicable field 
 Strain information
  CARD ID
2076 
Type of strain Spontaneous/Chemical induced mutant. 
Strain name C57BL/6-Bloc1s4cno 
Internal Code C57BL/6.cno2/cno2 
Submitter Ono Masao 
Submitter affiliation or code Department of Pathology, Tohoku University Graduate School of Medicine 
Stock Type  
Material Transfer Conditions No condition. 
 
Production method In-house breading.
 
Origin
(In-house)
Organization Tohoku University Graduate School of Medicine 
Organization code  
Developer Masao Ono 
Origin
(From other organizations)
Organization  
Organization code  
Developer  
Year introduced  
Introduced 
Generation
 
Remarks  
 
 Gene information
 Gene information 1
  Gene symbol
Bloc1s4 
Gene name biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino 
Allele symbol  
Allele name  
MGI MGI:1929230 
Chromosome 5 (5 B3 , 19.24) 
Gene classification Other gene(mutant etc.) 
Method  
OMIM
 
 Primer 1
  PCR Primer CIN-F4  GCCAAGGTGGACGAGTTCGTGGG 
CIN-R4  TGCGGTCTGTCACCGCAGCCAGG 
 

 Reference information
 reference information 1
  Author
Minako Yoshida et al. 
Title Cappuccino Mutation in an Autoimmune-Prone Strain of Mice 
Journal ARTHRITIS & RHEUMATISM 
Volume 54 
Page 2934–2943 
Year 2006 
PMID  
 
 Disease , Applicable field information
  Disease name,
Applicable field
Laboratory-animal Science