Center for Animal Resources and Development Database ! Home About CARD  
Home > Strains > Strain detail

Strain Detail

 - Strains   - Genes   - Disease,Applicable field 
 Strain information
Type of strain Targeted mutant. 
Strain name B6;129-Mll1tm1dHBM 
Internal Code MlldHBM 
Submitter Yokoyama Akihiko 
Submitter affiliation or code Kyoto University Graduate School of Medicine Medical Innovation Center Laboratory for Malignancy Control Research DSK project 
Stock Type  
Material Transfer Conditions It is necessary to consent to the submitter. 
Production method From other organizations.
Organization code  
(From other organizations)
Organization Stanford University Medical School 
Organization code Mlc 
Developer Michael L. Cleary 
Year introduced May 2009  
 Gene information
 Gene information 1
  Gene symbol
Gene name myeloid/lymphoid or mixed-lineage leukemia 1 
Allele symbol  
Allele name  
MGI MGI:96995 
Chromosome 9  
Gene classification Targeted or trapped gene(knockout etc.) 
Method Electroporation 
 Primer 1
  PCR Primer dHBM.fwd  aagtactggggagtgaacccaga 
dHBM.rev  aatctgaaaactgcctaactctacc 

 Disease , Applicable field information
  Disease name,
Applicable field
cancer, Cell biology, Molecular biology